Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
Hsa_circ_0058124 | |||
Gene | FN1 | Organism | Human |
Genome Locus | chr2:216270960-216274462:- | Build | hg19 |
Disease | Papillary Thyroid Carcinoma | ICD-10 | Malignant neoplasm of skin, unspecified (C44.9) |
DBLink | Link to database | PMID | 31324198 |
Experimental Method | |||
Sample Type | Tissue and cell lines | Comparison | PTC and paired adjacent normal tissues were obtained from 92 patients |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward CTTTGCAGTGAGCCATGGGA ReverseGAGTCGTCTCTCCTGTCACG | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
Citation | |||
Yao, Y, Chen, X, Yang, H, Chen, W, Qian, Y, Yan, Z, Liao, T, Yao, W, Wu, W, Yu, T, Chen, Y, Zhang, Y (2019). Hsa_circ_0058124 promotes papillary thyroid cancer tumorigenesis and invasiveness through the NOTCH3/GATAD2A axis. J. Exp. Clin. Cancer Res., 38, 1:318. |